Suitable for PCR amplification of high GC content fragments, various DNA labeling methods, and gene scanning based on PCR technology, etc.

· The specially formulated GC-Rich Buffer can amplify DNA fragments with a GC content up to 81% and a length of up to 5 kb.

· Ideal for PCR amplification that requires high fidelity, long amplification fragments, and high GC content.

Product Overview

2×GC-Rich PCR Mix is an optimized, two-fold concentrated PCR premix designed for PCR amplification with high fidelity requirements, long amplification fragments, and high GC content. The specially formulated GC-Rich Buffer allows for the amplification of DNA fragments with a GC content up to 81% and a length of up to 10 kb. The product is easy to use; simply combine 0.5 times the volume of the PCR system with 2×GC-Rich PCR Mix and the appropriate amount of GC-Rich Buffer, add primers and template, and top up the volume with ddH2O. Most of the target products amplified using 2×GC-Rich PCR Mix have an A base attached at the 3' end, allowing for direct cloning into T-Vector.

Transportation and Storage
Shipped under low-temperature conditions and stored at -20℃, with a shelf life of over two years.

Experimental Example:

Primers:
Forward: CTCGCAGGTAATTATTGCCAG
Reverse: GATGGACGCACCCTTG
(Human Klotho gene, containing an 81% GC sequence)

Electrophoresis gel image of PCR products: