This product is suitable for PCR amplification that requires high fidelity, various DNA labeling methods, and gene scanning based on PCR technology.

• · The Taq enzyme antibody, PCR enhancer, and protein stabilizer added to the product work together to improve PCR efficiency and sensitivity.
• · The synergistic action of Taq and Pfu enzymes not only ensures high fidelity of the amplified product but also guarantees the length of the amplified fragment. It can amplify fragments up to 4 kb from genomic DNA or up to 5 kb from λDNA.

Product Overview

2×Taq Plus PCR Master Mix is an optimized, two-fold concentrated PCR premix. The addition of Taq enzyme antibody, PCR enhancer, and protein stabilizer in the product synergistically improves PCR efficiency and sensitivity. The combined action of Taq enzyme and Pfu enzyme not only ensures high fidelity of the amplified product but also guarantees the length of the amplified fragment, allowing amplification of fragments up to 10 kb from complex genomic DNA. The product is easy to use; simply take 0.5 times the volume of the PCR system of 2×Taq Plus PCR Master Mix, add primers and templates, and top up the volume with ddH2O. Most of the target products amplified with 2×Taq Plus PCR Master Mix have an A base attached at the 3' end, which allows direct cloning into T-Vector.

Transportation and Storage

Shipped under low temperature conditions and stored at -20℃, with a shelf life of over two years.

Experimental Example:

Primers:

• Forward: GGTGTTCCCTTGATGTAGCACA
• Reverse: ACATGTATTTGCATGGAAAACAACTC

(Human β-globin gene, with a target gene length of approximately 3.6 kb)

Electrophoresis gel image of PCR products: