The product is easy to use, only need to take 0.5 times the system volume of 2×Taq PCR Master Mix, add primers and templates and ddH2O to make up the volume.

 

 

2×Taq PCR Master Mix is an optimized double concentration PCR premix. Taq enzyme antibodies, PCR enhancers, and protein stabilizers work together to improve PCR efficiency and sensitivity, making it ideal for low-copy template amplification. The optimized PCR amplification system of this product not only ensures the universality of PCR amplification from a variety of DNA templates from different sources, but also reduces the generation of non-specific amplification, which can amplify fragments up to 4 kb from genomic DNA or up to 5 kb from λDNA. The target product amplified by 2×Taq PCR Master Mix has an A base attached to the 3 'end and can be directly cloned into T-Vector.

 

 

 

 

Low temperature transport, -20℃ storage, valid for more than two years.

 

 

 

Primer: Forward TTAGGCCTTAGCGGGCTTAGAC

 

             Reverse  CCAGGATTTTTGATGGGACACG

 

             (Human β-globin gene, target gene length about 1.3kb)